104
Comments (54)
sorted by:
33
Afks 33 points ago +34 / -1

May the Good Lord be with you and bless you with a child, warrior

❤️

-39
Lord_Squidd -39 points ago +2 / -41

Why do you talk like a faggot?

23
Afks 23 points ago +24 / -1

Disappointing

-29
Lord_Squidd -29 points ago +2 / -31

Women aren't allowed here. Go do some dishes.

25
Afks 25 points ago +26 / -1

I don’t work in intelligence and so don’t have the demographic data of our community members, and, while I suspect there are more men here than women, I don’t think it’s entirely men

Regardless, women are fully welcomed here

Why wouldn’t I want our women properly educated?

Are you Jewish?

-24
Lord_Squidd -24 points ago +4 / -28

A woman is to be led, not educated. Go back to israel.lose fucking boomer simp piece of shit.

17
Afks 17 points ago +17 / -0

Every man and woman should have ConPro in their life and the world would be better for it

"Women aren't allowed here."

I hope you see differently someday, for everyone's sake

And not that it matters but I've been banned from there for 9 months for my riddler meme naming the Jew

10
MagneticArm 10 points ago +10 / -0

Stop feeding the troll

-13
Lord_Squidd -13 points ago +2 / -15

You fucking faggot. Get lost. I said women aren't allowed here.

14
GoldenInnosStatue 14 points ago +15 / -1

Basically, to quit Porn you have to accept god/religion into your heart

it can't be done without it because there is no mental barrier holding you back from the poison

8
rebuildingMyself 8 points ago +8 / -0

It's funny when I get into a decent nofap streak, I lose interest in a lot of other mindless shit. Vidya gets uninteresting, mindless TV does as well. I find more enjoyment from taking walks/jogs outside on a nice day, etc.

Religion helps as well because you cannot honestly destroy a bad habit, but you can replace it with something else. Religion is one avenue and is probably best one for long term mental health.

4
NoticerOfThings 4 points ago +4 / -0

Never used porn. Never had a desire. Didn't need God to tell me it was retarded, pathetic, and disgusting. Anyone who has a woman or girl in their life that they love will never accept porn as a normal part of life. God has more important things to do than help you not type disgusting porn keywords into your browser every night.

13
deleted 13 points ago +14 / -1
9
wellallright 9 points ago +9 / -0

Doing the lords work with a desire to awaken the masses, never change!

1
each 1 point ago +1 / -0

clot shot 1 - A simple restorative REPOST of deleted comment to repair master FUN FACT list at :
https://consumeproduct.win/p/15IEAPmBJS/x/c/4OYYmTeZpuK
https://consumeproduct.win/p/15IEAPmBJS/x/c/4OYYmTeZq2Z


FUN FACT : COVID-19 mRNA shot is meant to depopulate us [part 1 of 3]

many unranked loose snippets of FATS from me :

Papers in Dec 2021 show it now can insert tiny tiny fragments into DNA, and thus possibly alter egg cell dna too, and to allow this t happen you need to also be jabbed, but stillborns and first trimester self-aborts atre the biggest factor.

Overall White birth rate each month for 3 months is under 7% of normal for Whites. The clot shop would make it 14% less Whites if all whites took it.

This allows multiple retries, for single event impregnation it is far more dire.

FETUS FAILURES!

800% higher self aborts in FIRST TRIMESTER, proven.

And also third trimester dead increased some too!:

= = = =

13 Stillborn Deaths In 24 Hours – [email protected] Gate Hospital

https://www.eastonspectator.com/2021/11/18/15-stillborn-deaths-in-24-hours-rallylions-gate-hospital/

PROTEST AT LIONS GATE HOSPITAL AND RCMP ON NOV. 11

November 11th 1:00 – 3:00 Lions Gate Hospital Emergency Entrance, North Vancouver

Rally with Dr. Mel Bruchet and Dr. Daniel Nagase. They spoke to the RCMP, and then headed over to the emergency entrance. The Doctor will appreciate our support in standing with him to raise the awareness of the dangers of this experimental injection.

On average they would see 1 stillborn death a month. 3 dulas have reported that there were 13 stillborn deaths in a 24 hour period of women who had taken the experimental injection. The media is not reporting this. Big pharma looks after the media and the media is silent.

= = = =

21 babies under four weeks old died in September , double the normal death rate!!

https://theconservativetreehouse.com/blog/2021/11/23/they-said-vaccines-were-safe-for-pregnant-women-now-this-happens/

= = = =

Pfizer jab is 7 times worse than no jab for hospitalizations
: https://files.catbox.moe/vl09q8.pdf

Now many more similar papers exist.

= = = =

the clot-shot jabs , Pfizer BNT162b, Moderna mRNA-1273, are not vaccines they are a mRNA experimental fiasco, intended to screw with ACE-2 receptors, which are rich on placenta, though placenta itself in first trimesters is impossible for SARS-2 to cross because placenta lacks creation of TMPRSS2 enzyme, needed to pull in sars-2 coronavirus. But the jab is not sars-2 it is the spike proteins being made "factory style" and affecting various organs adversely.

THE JAB IS MEANT to reduce White births by 14% overall , and so far achieving 8% less White births!

The clot-shot jab is not RACE SPECIFIC, but the races that take it and accept it tend to be White.

It makes certain people infertile for up to 2 years (estimated), and has effects on placenta and even testicular tissue.

Many mechanisms, including stress to force survival response 21 day total menstruation cycles (a primate response to body under medical stress).

FETUS FAILURES!

800% higher self aborts in FIRST TRIMESTER. Though already a low percentage, the 800% self aborted (absorbed and miscarriages) multiplies the small number by 8 fold. It skyrockets.

The rate of first trimester miscarriages was between 10 and 26 percent years before SARS-2, such as the 2010s. In one paper, it was 82% for people jabbed in first trimester via math calculations from paper coverup.

82% miscarriages?!?! Yes:

https://pubmed.ncbi.nlm.nih.gov/33882218/
https://web.archive.org/web/20210630220634/https://pubmed.ncbi.nlm.nih.gov/33882218/
June 17 2021 : Preliminary Findings of mRNA Covid-19 Vaccine Safety in Pregnant Persons

700 study participants, or 84.6 percent, received their first eligible dose of a Wuhan Flu shot during the third trimester. So, a total of 96 out of 104 spontaneous abortions, or 92.3 percent, occurred before 13 weeks of gestation!

(first trimester is all the self aborts)!

that New England Journal of Medicine in June 2021 published :

104 out of 127 pregnancies were lost post-injection in First Trimester study (if jabbed while pregnant)

This overall problem resulted in 8% less live births in August 2021 than expected for USA Whites overall. 8% less births!!!

I scanned 134 science papers 17 weeks ago for all possible published and pre print papers on this effect (the 8% less live births and reports of miscarriages). All 134 papers start covering only anomalies of the jabbed AND ALL 134 PAPERS only track problems AFTER first trimester.

All 134 science studies tracked miscarriages in jabbed in SECOND or THIRD trimester only. EVERY.FUCKING.PAPER.

That one paper tried to pretend no problems in 2nd and 3rd trimester... fine. OK. But it revealed that instead of natural failure of 10 and 26 percent in first trimester, it skyrocketed to 92.6% birth failures!

92.6% lost pregnancies (if jabbed DURING first trimester)!!!!!

If jabbed long before pregnant... still big problems.

Lack of papers is a coverup.

One brave scientist warned us 1.5 years ago :

Ex-Pfizer Chief Science Officer: COVID-19 Vaccine Can Make Females Infertile

Syncytin 1 (along with HERV-FRD or Syncytin 2) is expressed in first-trimester placenta and required for cell–cell fusion to enable formation of syncytiotrophoblast and effective placentation. Syncytin 1 is also found in homologous form in the spike proteins of SARS viruses!

A good mRNA jab will attack first trimester placenta!!:

https://virological.org/t/response-to-ncov2019-against-backdrop-of-endogenous-retroviruses/396

OMG! This was their fucking plan all along! A way to cut back on White populations stupid enough to take this unneeded Jab.

No animal fertility papers exist!

No animal fertility papers either. No primates, no golden hamsters, no rats, nothing.

I wasted hours looking through the 134 papers. I was trying to see if the experts on Alex Jones were wrong or right.

They were right. It's a fucking coverup. But you can't hide 8% less White births forever and blame on economy.

The jab is to control White populations, just like the PUBLISHED essays, speeches, lectures, papers, from 4 years ago were seeking. Thanks, Jews, and thanks, Bill Gates.

= = = =

COVID vaccinated women experience a 13.9% pregnancy loss.

Source: http://archive.today/tuQQQ

Textbin version: http://archive.today/gyZPq

= = = =

Jabbed people have barely any functioning immunity.

https://thenationalpulse.com/2021/12/31/vaccinated-21-times-more-likely-to-get-omicron

Over 95 percent of reported cases of the Omicron COVID-19 variant in Germany
occurred in fully vaccinated individuals, according to a new report from the
federal government.

The paper – published December 30th by the German agency the ‘Robert Koch
Institute’ – included information on the vaccination status of 4,206
individuals who contracted the latest variant of the virus.

https://www.rki.de/DE/Content/InfAZ/N/Neuartiges_Coronavirus/Situationsberichte/Wochenbericht/Wochenbericht_2021-12-30

https://files.catbox.moe/azc5dr.pdf

Four thousand and twenty people who reported contracting Omicron in the study
– which equates to 95.6 percent of total cases – had received at least two
doses of COVID-19 vaccines. Twenty-eight percent of the Omicron-positive group
had also received a third dose or “booster” shot.

Just 186 people contracting Omicron were unvaccinated in the entire sample,
showing that vaccinated individuals were over 21 times as likely to contract
the COVID-19 variant.

“For 6,788 cases, information on the symptoms was provided, mostly no or mild symptoms were reported. 124 patients were hospitalized, four people died.”

= = = =

= = = = =

Dec 7 2021 : 90% in ICU for covid were CLOT SHOT JABBED!!!!

85% jabbed in wales!

https://files.catbox.moe/jcjou3.jpeg

= = = =

100% jabbed in Gibralter! holy shit
Dec 1 Gibralter 100% vaccinated Pfizer shot gets 60 new covid-19 cases per DAY!

Gibraltar proves that vaccination does not stop Covid
https://livebeyondborders.substack.com/p/gibraltar-proves-that-vaccination

Among those over 60 years of age, the share of the vaccinated Covid cases is even 92%.
https://twitter.com/GibraltarGov

= = = =

NO ONE CAN CATCH OMICRON WITHOUT PRIOR GETTING THE CLOT-SHOT JAB! :

‘OMICRON’: All 4 out of 4 people! Four People With New COVID African/China Variant Were ‘Fully Vaccinated,’ Botswana Government Reports. All of them had the CLOT-SHOT JAB:

https://files.catbox.moe/dyox1u.png

Just like 85% to 100% of USA Hospitals last week! (100% at Michigan Henry Ford 300:300 had the jab in ICU) !

AND ALL WERE JABBED if they tested positive.

This is a fact so far.

All US people getting omicron were jabbed:

https://www.zerohedge.com/markets/everything-tumbles-after-second-us-omicron-case-identified-minnesota

= = = =
CDC: Only 21% Of Omicron Cases Occurred In Unvaccinated People1
https://www.dailywire.com/news/cdc-only-20-of-omicron-cases-occurred-in-unvaccinated-people

Just 20% of COVID-19 cases caused by the Omicron variant, based on an examination of diagnoses from December 1-8.
There were 43 cases attributed to Omicron; 34 were among people who had been “fully vaccinated.”
What’s more, one-third of the 34 had also received a third “booster” shot. Just one of those suffering from Omicron was briefly hospitalized.

the Clot-Shot SPREADS SARS-2 (COVID-19)!

(NEWS) 2021.11.29 : CDC-funded study: COVID shots have no effect on virus transmission! (in fact the Clot-Shot SPREADS SARS-2 (COVID-19) !! No effect now Proven! Other larger studies concur. (www.wnd.c

https://www.medrxiv.org/content/10.1101/2021.11.12.21265796v1.full.pdf

https://www.wnd.com/2021/11/4964327/

https://www.wnd.com/2021/10/lancet-study-vaccinated-likely-unvaccinated-spread-delta-variant/

The Centers for Disease Control identifies four of the top five U.S. counties with the highest percentage of the population fully vaccinated (99.9–84.3%) as "high" transmission counties.

= = = =

END PART 1 of 3

6
RefriedGringo 6 points ago +6 / -0

Any correlation between the clotShot and cancer?

6
deleted 6 points ago +7 / -1
4
RefriedGringo 4 points ago +4 / -0

I am seeing a lot of death notices and cancer notices in the 30-60 year old crowd and since they’re announced on social media I assume they’re leftist and I assume they’ve had the SHOT.

Thanks for the info. You’re a gem.

3
Thatunknownguy 3 points ago +3 / -0

= = = = 68,000% Increase in Strokes Following COVID-19 Vaccines!: https://vaccineimpact.com/2022/68000-increase-in-strokes-as-fda-and-hih-secretly-study-reports-of-neurological-injuries-after-covid-19-vaccines/

Hit home. My grandad has had 2 strokes within a year of getting the vaccine.

1
each 1 point ago +1 / -0

clot shot 2 - A simple restorative REPOST of deleted comment to repair master FUN FACT list at :
https://consumeproduct.win/p/15IEAPmBJS/x/c/4OYYmTeZpuK
https://consumeproduct.win/p/15IEAPmBJS/x/c/4OYYmTeZq2Z


Cancer?

ABSOLUTELY! Due to CD8 T-Cell loss, cancers skyrocket!

FUN FACT : COVID-19 mRNA shot is meant to depopulate us [part 2 of 3]

many unranked loose snippets of FACTS from me :

= = =

PART 2 of 2

= = = = = =

If you take the covid vax, you can NEVER achieve full immunity again – government stats unveil the horrifying truth

https://archive.ph/1jgkk#selection-209.0-219.0

https://bigpharmanews.com/2021-10-24-take-covid-vax-never-full-immunity-again.html

= = = = = =

NOTE THE CD8 T-Cell type column!!!

https://files.catbox.moe/vbyn6o.jpg

See? I annotated it. It concurs with many large studies.

CD8 starts above norm healthy then DEVASTATED!!!! Look at range column! Sub acceptable CD8 T-cell type!

CD8 kills off little cancers found in body early. 40% of CD8 are gone for a year or more after you take a clot-shot.

Without CD8 , anal cancer will spike, HPV cancer, cervical cancer.

Immuno-oncologists have discovered that T-cells also seek and destroy cancer cells all the time, which keeps the body in a state of equilibrium.

The discovery of the role the immune system plays in fighting cancer highlights the importance of T-cells recognizing cancer cells as invaders.

Immuno-oncology

US Cancer Statistics dataset for 2020 and 2021 are shoahed : United States Cancer Statistics (USCS)

https://www.cdc.gov/cancer/uscs/dataviz/download_data.htm

HPV cancers like 'Squamous cell carcinoma of the anus (SCCA)' will be the one to watch in jabbed vs unjabbed

and 'average annual percentage change (AAPC)' for next month vs last year or year before same month.

But 2019 is now offline at CDC. Shoahed due to the volcano brewing in the jabbed for cancers about to skyrocket.

Other US cancer registries exist though. As do other nations.

Squamous cell carcinoma of the anus (SCCA) is the most common histologic subtype of anal cancer, and more than 90% of incident cancers are associated with human papillomavirus (HPV) , thus I predict , if HONEST database records, a 100% or more jump in SCCA cancer in MAY 2022 vs MAY 2019.

= = = = = =

I was RIGHT in my old over half a year ago prediction!:

US Military snitch tweet Jan 25 2022, from one cancer tally of "billing codes" database :

https://files.catbox.moe/utd787.jpeg

The news in more detail.

https://www.theblaze.com/op-ed/horowitz-whistleblowers-share-dod-medical-data-that-blows-vaccine-safety-debate-wide-open
= = = = = =

US Military data showed a 988% increase in reported diseases and injuries, from 1.98 million in 2020, to 21.5 million in 2021

https://files.catbox.moe/k10s7o.jpg

https://www.wnd.com/2022/02/pentagon-flubs-response-recorded-spike-injuries-possibly-tied-vaccines/

registered diagnoses for neurological issues increased 10 times from a five-year average of 82,000 to 863,000 in 2021 and an increase from 2020 to 2021 in the following conditions: hypertension (2,181%), diseases of the nervous system (1,048%), malignant neoplasms of esophagus (894%), multiple sclerosis (680%), malignant neoplasms of digestive organs (624%), Guillain-Barre syndrome (551%), breast cancer (487%), demyelinating (487%), malignant neoplasms of thyroid and other endocrine glands (474%), female infertility (472%), pulmonary embolism –(468%), migraines – 452% increase, ovarian dysfunction (437%), testicular cancer (369%), tachycardia (302%)

= = = = = =

CLOT SHOT ruins immune system for months or years!

Mayo Clinic-trained Doctor Says Covid-19 Vaccines Suppress the Immune System, Making People More Prone to HIV, Shingles and Herpes

CD8 cells

https://dailyexpose.uk/2021/11/22/mayo-clinic-trained-doctor-says-covid-19-vaccines-suppress-the-immune-system-making-people-more-prone-to-hiv-shingles-and-herpes/

WOW!

Dr Cole added that he has also seen a massive spike in cancer. He warns that there is now 20 times the normal average of certain types of cancers ever since the Covid-19 vaccine programme started.

“Now most concerning of all is there’s a pattern of these types of immune cells in the body that keep cancer in check,” Dr. Cole says. “Well, since January 1 in the laboratory I’ve seen a 20 times increase of endometrial cancers over what I see on an annual basis – a 20 times increase and I’m not exaggerating at all.”

= = = =


Ivermectin
Ivermectin
Here are a ton of Ivermectin links.

https://patriots.win/p/12kFwWqqxx/x/c/4JEWdG3IkXQ

= = = =

https://joelshirschhorn.substack.com/p/good-news-from-japan-ivermectin-works

“Ivermectin was allowed as a treatment on August 13 and after 2 weeks the cases started to come down. In fact, they are now down 99 percent from the peak.
= = = =

COVID-19 was really mostly always influenza (unrelated virus species)

https://www.zerohedge.com/covid-19/bombshell-admission-cdc-drops-post-isolation-pcr-test-because-they-can-remain-positive-12

In Bombshell Admission, CDC Drops Post-Isolation PCR Test Because They Can 'Remain Positive Up To 12 Weeks'

Just when you thought things couldn't get more absurd, the Biden administration is now dropping PCR tests from its Covid end-of-isolation guidelines because they can stay positive for up to 12 weeks.

"So we would have people in isolation for a very long time if we were relying on PCRs," said CDC Director Rochelle Walensky on a Wednesday appearance on "Good Morning America."

https://www.zerohedge.com/markets/cdc-makes-major-changes-covid-isolation-recos-treats-unboosted-unvaxxed-quarantines

= = = =

2022.05 - Mask mandates increase death rate
https://www.wnd.com/2022/05/study-mask-mandates-increase-death-rate/

mask mandates actually caused about 1.5 times the number of deaths or ∼50% more deaths compared to no mask mandates

= = = =

List of 30 out of 30 large science paper studies showing face masks are useless against COVID-19, and actually prove masks make it worse!

[masks increases it slightly!]

https://www.medrxiv.org/content/10.1101/2021.05.18.21257385v1.full-text

https://swprs.org/face-masks-evidence/

https://pubmed.ncbi.nlm.nih.gov/29395560/

https://pubmed.ncbi.nlm.nih.gov/32590322/

https://pubmed.ncbi.nlm.nih.gov/15340662/

https://pubmed.ncbi.nlm.nih.gov/26579222/

https://pubmed.ncbi.nlm.nih.gov/31159777/

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4420971/

https://www.medrxiv.org/content/10.1101/2020.04.01.20049528v1

https://www.medrxiv.org/content/10.1101/2020.03.30.20047217v2

https://www.nejm.org/doi/full/10.1056/NEJMp2006372

https://jamanetwork.com/journals/jama/fullarticle/2749214

https://www.cmaj.ca/content/188/8/567

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5779801/

https://pubmed.ncbi.nlm.nih.gov/19216002/

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4420971/

https://academic.oup.com/cid/article/65/11/1934/4068747

https://www.jstage.jst.go.jp/article/bio/23/2/23_61/_pdf/-char/en

https://link.springer.com/article/10.1007/BF01658736

https://www.journalofhospitalinfection.com/article/0195-6701(91)90148-2/pdf90148-2/pdf)

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2493952/pdf/annrcse01509-0009.pdf

https://web.archive.org/web/20200717141836/https://www.cidrap.umn.edu/news-perspective/2020/04/commentary-masks-all-covid-19-not-based-sound-data

https://www.nap.edu/catalog/25776/rapid-expert-consultation-on-the-effectiveness-of-fabric-masks-for-the-covid-19-pandemic-april-8-2020

https://www.nap.edu/read/25776/chapter/1#6

https://wwwnc.cdc.gov/eid/article/26/5/19-0994_article

https://academic.oup.com/annweh/article/54/7/789/202744

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6599448/

https://www.acpjournals.org/doi/10.7326/M20-1342

https://link.springer.com/article/10.1007/s00392-020-01704-y

https://clinmedjournals.org/articles/jide/journal-of-infectious-diseases-and-epidemiology-jide-6-130.php?jid=jide

https://www.sciencedirect.com/science/article/abs/pii/S1130147308702355

masks make SARS-2 rate (covid-19) WORSE, not better in all large studies

= = =

6-Year-Old With VAXX-Induced Myocarditis ‘Unable to Walk,’:
https://noqreport.com/2022/02/11/6-year-old-with-vaxx-induced-myocarditis-unable-to-walk-as-reports-of-deaths-injuries-after-covid-jabs-climb-steadily/

The Centers for Disease Control and Prevention (CDC) today released new data showing a total of 1,103,893 reports of adverse events following COVID vaccines were submitted between Dec. 14, 2020, and Feb. 4, 2022, to the Vaccine Adverse Event Reporting System (VAERS).

= = = =

proof that vaccines kill a month or two later : Jan 2022, one jab is enough to kill

https://leakedreality.com/video/31030/organs-of-dead-vaccinated-proves-auto-immune-attack
Organs Of Dead Vaccinated Proves Auto Immune Attack

Here's a link to Burkhardt's study
https://doctors4covidethics.org/on-covid-vaccines-why-they-cannot-work-and-irrefutable-evidence-of-their-causative-role-in-deaths-after-vaccination/ which BTW didn't appear on Google.

= = = =

primer : mRNA Toxicity with Dr. Michael Palmer
https://www.bitchute.com/video/R6O8768RoWxm/

= = = =

NEGATIVE vaccine efficacy

New studies show that the COVID vaccines damage your immune system, likely permanently

The vaccines are making it more likely you'll be infected with Omicron 90 days after you are fully vaccinated. To keep vaccine effectiveness high against omicron, vaccination every 30 days is needed, or else never get a vaccination for more protection

Update Jan 7, 2022: The numbers in the Denmark study described below are now confirmed by government data from Germany showing that vaccinated people are 8X more likely to develop Omicron than unvaccinated people.

https://dailyexpose.uk/2022/01/02/german-gov-data-suggests-fully-vaccinated-developing-ade/

This study shows that after three months the vaccine effectiveness of Pfizer & Moderna against Omicron is actually negative. Pfizer customers are 76.5% more likely and Moderna customers are 39.3% more likely to be infected than unvaxxed people.

https://www.medrxiv.org/content/10.1101/2021.12.20.21267966v2.full.pdf+html

https://twitter.com/ezralevant/status/1474106318206255113?s=21

https://stevekirsch.substack.com/p/new-study-shows-vaccines-must-be

= = = =

This is not surprising since a paper from Germany showed the same thing: the more you vaccinate, the worse it gets.

https://stevekirsch.substack.com/p/new-study-from-germany-confirms-higher
Worried about Omicron? Guess what? After 90 days, the vaccine they gave you is going to make you MORE likely to get infected from Omicron, not less. The longer you stay on the vaccine treadmill, the harder to get off in the future and the easier you’ll make it for the virus.

= = = =

Jan 2022 : Henry Ford Hospital in Michigan with over 99% Vaccination Compliance Rate has Nearly 700 Employees Test Positive with COVID-19:

https://www.thegatewaypundit.com/2022/01/health-system-michigan-99-vaccination-compliance-rate-nearly-700-employees-test-positive-covid-19/

Infected and jabbed can keep working!
non-positive but unjabbed FIRED or BANNED!

= = = =

END PART 2 of 3

3
each 3 points ago +3 / -0

clot shot 3 - A simple restorative REPOST of deleted comment to repair master FUN FACT list at :
https://consumeproduct.win/p/15IEAPmBJS/x/c/4OYYmTeZpuK
https://consumeproduct.win/p/15IEAPmBJS/x/c/4OYYmTeZq2Z


FUN FACT : COVID-19 mRNA shot is meant to depopulate us [part 3 of 3]

many unranked loose snippets of FACTS from me :

= = =

Jan 11 2022 : Massive 145-Country Study Shows Sharp INCREASE Of Transmission And DEATH After Introduction Of COVID Vaccines
https://seemorerocks.is/massive-145-country-study-shows-sharp-increase-of-transmission-and-death-after-introduction-of-covid-vaccines/
38% more Covid cases per million – and an even more astonishing 31% increase in deaths per million

https://www.researchgate.net/profile/Kyle-Beattie/publication/356248984_Worldwide_Bayesian_Causal_Impact_Analysis_of_Vaccine_Administration_on_Deaths_and_Cases_Associated_with_COVID-19_A_BigData_Analysis_of_145_Countries/links/61931b0507be5f31b78710a8/Worldwide-Bayesian-Causal-Impact-Analysis-of-Vaccine-Administration-on-Deaths-and-Cases-Associated-with-COVID-19-A-BigData-Analysis-of-145-Countries.pdf
https://files.catbox.moe/4xk9zy.pdf

= = = = =

1 in 191 died from vaxx at age 60 and over

December 17, 2021 = Relationship Between Covid-19 Vaccination and All Cause Mortality
https://hatchardreport.com/relationship-between-covid-19-vaccination-and-all-cause-mortality/

As weekly vaccination numbers rise to a peak, deaths peak.

As vaccination numbers begin to fall, deaths also fall.

https://www.youtube.com/watch?v=VVxmAIKjYM4

= = = = =

Nobody dies "from" covid. It's either WITH covid or from the vaccine

First 6 months of 2021 England :

https://files.catbox.moe/rac2gk.png

= = = =

UK vaccinated people are loosing 5% immune system efficiency each week!!!

https://www.bitchute.com/video/hIraXyHKc4bS/

https://www.bitchute.com/video/SMFYtgPkb9Kq/

Dr Tenpenny reading Public Health England data which suggests UK vaccinated people are loosing 5% immune system efficiency each week, over 30 year olds may have zero covid viral defence by Christmas

= = = =

May 29 2022 = CONFIRMED: 70K people dead within 28 Days of Covid-19 Vaccination in England; & 179K dead within 60 Days

for National Statistics has revealed that between January 2021 and March 2022 a total of 69,466 people died within 28 days of Covid-19 vaccination, and 109,408 people died within 60 days of vaccination in England.

https://expose-news.com/2022/05/29/70k-dead-28-days-covid-vaccination-2/

https://archive.ph/8DIau

Gov published it over 17 months after the first time of asking !

A difference of 220.4% more all-cause mortality!

Twice as likely to die from clot shot than no shot.

= = = =

The spike protein from COVID-19 and the injections cause auto-immune disease. Everyone has a type of AIDS with or without clot-shot.

"On Jan 24, a real zinger was dropped onto the medRxiv preprint server that could potentially explain many of the commonly observed pathogenic features of SARS-CoV-2. The authors provide solid evidence that the SARS-CoV-2 spike protein activates the envelope (ENV) protein encoded by HERV-W in blood cells, which is in turn directly responsible for many pathological features of the disease."

Jan 24 2022 : SARS-CoV-2 spike protein activates human endogenous retroviruses in blood cells
https://phys.org/news/2022-01-sars-cov-spike-protein-human-endogenous.html

doi: https://doi.org/10.1101/2022.01.18.21266111
https://www.medrxiv.org/content/10.1101/2022.01.18.21266111v2

https://www.thelancet.com/journals/ebiom/article/PIIS2352-3964(21)00134-1/fulltext

https://twitter.com/TheChiefNerd/status/1485695818996854788

https://archive.4plebs.org/pol/thread/358982609/#358982609

comedy : Team America World Police - Everyone Has AIDS
https://youtu.be/Prhi3_Nvt3U

clot shot seizures : THAT MEANS ITS WORKING
https://youtu.be/lV81IUQS9w0

= = = =
68,000% Increase in Strokes Following COVID-19 Vaccines!:
https://vaccineimpact.com/2022/68000-increase-in-strokes-as-fda-and-hih-secretly-study-reports-of-neurological-injuries-after-covid-19-vaccines/

2385 cases of stroke per year following COVID-19 vaccines

3.5 cases of stroke per year following all FDA-approved vaccines combined

That’s an astounding 68,043% increase in the cases of stroke following COVID-19 vaccines!

U S Military database records are almost similar increase

= = = =

Stay away from the vaccinated, it’s official, from Pfizer’s own docs

https://anonymouswire.com/stay-away-from-the-vaccinated-its-official-from-pfizers-own-docs/

= = = =

82 studies (not the Trump Cure though, HCQ + Macrolide) showed great aid for HCQ:

https://c19ivermectin.com/

https://ivmmeta.com/

= = = =

Fauci lied :
https://www.wnd.com/2022/04/fauci-corrected-trump-covid-ivermectin-maintain-integrity/

= = = =

2022: Fauci and the CDC lied: MRNA “vaccines” do convert to DNA, altering the human body’s genome:
https://anonymouswire.com/fauci-and-the-cdc-lied-mrna-vaccines-do-convert-to-dna-altering-the-human-bodys-genome/

Fauci Flu shots do, in fact, alter human DNA permanently

Gearing up for the BIG REVEAL: HHS releases FDA gene editing guidance, may soon admit mRNA COVID shots are actually gene therapy products:
http://geneticlunacy.com/2022-04-01-hhs-releases-fda-gene-editing-guidance.html

https://www.theepochtimes.com/mkt_app/pfizers-covid-19-vaccine-goes-into-liver-cells-and-is-converted-to-dna-study_4307594.html

BNT162b2 mRNA is reverse transcribed intracellularly into DNA as fast as 6 [hours] after BNT162b2 exposure

= = = =

Forbes Jew media comedy meme on its media spin :

https://u.smutty.horse/mfnsshihmcu.jpg

The meme is comedy, but it is factual though!

https://archive.fo/QpJk0
https://archive.fo/wHoBf

"GACCCCAAAATCAGCGAAAT" was shown inserted into DNA in Dec 2020 paper, and other papers :
https://files.catbox.moe/mg9m18.pdf

= = =

Sky News Australia 2022.01 Fauci paid to create Sars-2 and lied
https://www.bitchute.com/video/bXfgyWoTO3kl/

= = =

Feb 22 2022 : CDC Officials Admit Agency Has Withheld Critical Covid Information From the Public, Including Data About Breakthrough Infections, Over Fears of “Vaccine Hesitancy”

https://www.thegatewaypundit.com/2022/02/cdc-officials-admit-agency-withheld-critical-covid-information-public-including-data-breakthrough-infections-fears-vaccine-hesitancy/

= = =

MONKEY POX:

A side effect of the Pfizer vaccine is alleged to be a 'blistering disease' called Pemphigoid. Pemphigoid is an autoimmune response that creates blisters on the skin. Has anyone had this happen to them after taking the jab? WHO of the NWO is not to be trusted!

https://web.archive.org/web/20220523112222/https://twitter.com/foursticks_nate/status/1527687239962177536

= = =

No approved vaccine (Pfizer Comirnaty) in usa , all lies !
https://www.thegatewaypundit.com/2022/02/military-vaccine-bait-switch-dod-trying-pull-off-regarding-non-availability-mandated-fda-approved-shots/

= = =

But the JEW media calls the jabbed "UNVACCINATED PEOPLE" for the last 3 weeks because the goal posts shifted to THREE or FOUR clot-shots to be called "vaccinated" !!!!

hah ahha hahhah hah hah hah!

Truth: ONLY the clot-shot jabbed so far got OMICRON, and luckily for them its jus sniffles.

JEWS ARE TRYING TO PASS EMERGENCY no-ID voting and MAIL IN VOTING only for 2022 midterms to ruin the remains of the USA with jew marxism!

Its more democrat jew tricks!

omicron is a leftist trick!

and if you want to stay healthy, be a PURE BLOOD!

And vote these democrat fuckheads out of office.

END PART 3 of 3

TL/DR: The COVID-19 mRNA shot is meant to depopulate us

3
Zogdanov 3 points ago +3 / -0

Were is the hero we need for times like these

5
deleted 5 points ago +5 / -0
4
BlackFang4 4 points ago +4 / -0

God bless you, sir. The last few months I have been having great success with continual prayer for when I am tempted. I'm not perfect yet, but I can the ice of my addiction is starting to melt

4
Kekistan_United 4 points ago +4 / -0

i get what you are saying OP. i do.

but most have never even been in a relationship to even get close to having a child.

you are far on the other side of the curve, looking back at the 'have nots'.

but really, you are seeing through a mountain, at others on the oppposite side.

i agree its not insurmountable.

4
Oitthegroit 4 points ago +4 / -0

May God bless you and keep you safe. Peace, brother. 💪🙏

3
AverageConsoomer420 3 points ago +5 / -2

Meaningful sex with a woman you love and care for is far greater than degenerate filth produced by those who HATE you

No shit, but that's out of reach for the majority. It doesn't do any good to point out an alternative most guys will never experience.

9
deleted 9 points ago +9 / -0
2
AverageConsoomer420 2 points ago +3 / -1

I never thought I'd find someone I'd consider worthy of trying to start a family with.

It's not even about finding a girl who's worthy, it's the difficulty of finding a white woman in the right age range(of which I typically don't even meet one per year), and on top of that she has to have standards dramatically lower than most to settle for a guy who's just average(which it would be generous to call me). Those are just the basic requirements though, if I included important preferences as well then she can't be fat(I'd say the majority of women I see are) and not a slut(which is like finding a needle in a hay stack).

2
Kekistan_United 2 points ago +2 / -0

this. again.

most women of todays culture have been normalized to think their 'sexual freedom' has been part and parcel to their happiness. obvious motivators and having been manipulated... whole other topic.

but now, theres a whole generation of women that are THE UNHAPPIEST generation of women, ever, in history.

whyyyyy would i put my dick in something that has been programmed to be miserable?

its like agreeing to walk around with shackles.

like its part of a plan...

6
BadLuckBlues 6 points ago +6 / -0

News flash, you are not entitled to sexual pleasure. You will not die if you forgo cooming. This is a major problem with the mindset of modern society which values pleasure above all else.

2
AverageConsoomer420 2 points ago +3 / -1

He's not talking about forgoing ejaculation entirely though, he's just talking about an unrealistic alternative to masturbation.

2
RefriedGringo 2 points ago +4 / -2

If I ever lose my wife my plan is to go to Latin America, go to the Catholic Church, and find a wife. Colombia, Ecuador, Uruguay have some real beauties. I’d probably stay down there, if possible.

2
Kekistan_United 2 points ago +3 / -1

came here to say this as well...

one could argue that the reason porn usage has increased is the realization that the most will never access the relationshits, that OP says is what you should desire.

so yeh. just pray away these evolutionary desires.

lols.

3
BLMadeMeRaysis 3 points ago +3 / -0

Thank you for the wisdom and encouragement, I am proud to share ancestry with you. May God bless both you and your wife.

-8
KeepWomanInTheHouse -8 points ago +1 / -9

No fap is a invention of the Jews to brainwash white males into disregarding their sex drive so they stop pursuing women | prove me wrong. Why do so many many homos here want to disregard their genitals?

-22
Lord_Squidd -22 points ago +1 / -23

Dudes can't get pregnant.

21
Afks 21 points ago +23 / -2

Father lost his child mid pregnancy

Not a time for jokes

Your head: give it a shake, fren

❤️

-21
Lord_Squidd -21 points ago +1 / -22

He should have kept better track of it then.

17
RefriedGringo 17 points ago +18 / -1

You’re an unfunny asshole. You’re acting like a drunk. Get your shit together

-11
Lord_Squidd -11 points ago +2 / -13

At least I'm not virtue-signaling for attention by airing out my business on a forum full of losers. You faggots love talking about touching your dick. I think it makes you horny for more dick.

12
RefriedGringo 12 points ago +13 / -1

This is ConPro and I assume the dude is honestly looking for support. If it was FB I’d assume he’s looking for sympathy. There’s a difference

-10
Lord_Squidd -10 points ago +1 / -11

There is not. Men do not look for support. Go to a woman's group for that. You can pat each other on the back and tell each other "there there, there there" and cry into a tissue like the little bitch you are.

5
RefriedGringo 5 points ago +6 / -1

It’ll be interesting to see what happens when your life takes an unexpected turn.

5
NoticerOfThings 5 points ago +5 / -0

I pray you don't ever have to suffer the pain of the loss of a child